| Sequence ID | >C181215541 |
| Genome ID | LS483470 |
| Phylum/Class | Gammaproteobacteria |
| Species | Leminorella richardii NCTC12151 [LS483470] |
| Start position on genome | 2175338 |
| End posion on genome | 2175425 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
agcaaaatac |
| tRNA gene sequence |
GGTGAGATGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATC |
| Downstream region at tRNA end position |
tattttaaga |
| Secondary structure (Cloverleaf model) | >C181215541 Ser GGA
c GCCA tattttaaga
G - C
G - C
T - A
G - C
A - T
G - C
A - T T A
T C T C C C A
T G A G | | | | | G
G G C C T G A G G G C
G | | | T T
C A G G A
T G A G TATACGGCAACGTATC
C - G
A - T
C - G
G + T
C - G
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |