Sequence ID | >C181224791 |
Genome ID | LT906446 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Megamonas hypermegale NCTC10570 [LT906446] |
Start position on genome | 1798698 |
End posion on genome | 1798773 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
attataaaat |
tRNA gene sequence |
GGGCGGTTAGCTCAGCTGGGAGAGCGCTTGCCTTACAAGCAAGATGTCAGCAGTTCGATC |
Downstream region at tRNA end position |
ctacggcccg |
Secondary structure (Cloverleaf model) | >C181224791 Val TAC t ACCA ctacggcccg G - C G - C G - C C - G G - C G - C T - A C T T T T G T C A C G A A | + | | | G T C T C G A G C A G C G | | | | T T G G A G C G A G ATGTC C - G T - A T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |