Sequence ID | >C181225999 |
Genome ID | LT906468 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Sphingobacterium mizutaii NCTC12149 [LT906468] |
Start position on genome | 978337 |
End posion on genome | 978263 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
accgaaaaac |
tRNA gene sequence |
GGCGGGGTAGCTCAGATGGTTAGAGCGCAGGATTCATAACCCTGAGGTCGGCAGTTCGAT |
Downstream region at tRNA end position |
gaaaaaaagc |
Secondary structure (Cloverleaf model) | >C181225999 Met CAT c ACtg gaaaaaaagc G + T G - C C - G G - C G - C G - C G - C C T T T C G T C A A G A A + | | | | G T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |