Sequence ID | >C181226100 |
Genome ID | LT906470 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Veillonella rodentium NCTC12018 [LT906470] |
Start position on genome | 500703 |
End posion on genome | 500613 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cgtaaagcac |
tRNA gene sequence |
GGAGGAGTACCCAAGAGGCTGAAGGGTCCGCACTCGAAATGCGGTAGGTCGGGCAACCGG |
Downstream region at tRNA end position |
cataacatgc |
Secondary structure (Cloverleaf model) | >C181226100 Ser CGA c GCCA cataacatgc G + T G - C A - T G - C G - C A - T G - C T A T C T C C C A A G A A | + | | | A G A C C C G G G G G C G | | | T T C A G G G T G A T TAGGTCGGGCAACCGGCGC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |