Sequence ID | >C181226993 |
Genome ID | LT907975 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Pseudodesulfovibrio profundus 500-1 [LT907975] |
Start position on genome | 3895281 |
End posion on genome | 3895205 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gaagcccagc |
tRNA gene sequence |
GCGCCAGTAGCTCAGTTGGATAGAGCATCGGCCTTCTAAGCCGACGGCCGGGGGTTCGAA |
Downstream region at tRNA end position |
gtatttcaag |
Secondary structure (Cloverleaf model) | >C181226993 Arg TCT c GCCA gtatttcaag G - C C - G G - C C - G C - G A - T G - C T A T C C T C C A T G A A | | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A CGGCC T - A C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |