Sequence ID | >C181230162 |
Genome ID | LT990688 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium diphtheriae subsp. lausannense CHUV2995 [LT990688] |
Start position on genome | 1405134 |
End posion on genome | 1405060 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cggaagcgga |
tRNA gene sequence |
CGGACTATGGCGCAGCTTGGTAGCGCACTTGACTGGGGGTCAAGGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
attaatgtga |
Secondary structure (Cloverleaf model) | >C181230162 Pro GGG a ACaa attaatgtga C - G G - C G - C A - T C - G T - A A - T T A T T G T C C A C G A G + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |