Sequence ID | >C191001224 |
Genome ID | AP018202 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Thermostichus vulcanus NIES-2134 [AP018202] |
Start position on genome | 1268985 |
End posion on genome | 1268911 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaacaggctT |
tRNA gene sequence |
GCGTCCTTAGTTCAGTTGGTAGAACGTCGGTCTCCAAAACCGGATGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
cgacagacag |
Secondary structure (Cloverleaf model) | >C191001224 Trp CCA T GTta cgacagacag G - C C - G G - C T + G C - G C - G T - A T G T C C T C C A T G A A | | + | | G T C T T G G G G G G C G | | | | T T G G A A C T A G ATGTC T + G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |