Sequence ID | >C191002770 |
Genome ID | AP018518 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingobium sp. YG1 [AP018518, AP018519] |
Start position on genome | 692732 |
End posion on genome | 692647 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acgaagccat |
tRNA gene sequence |
GCGGACGTGGCGAAATCGGTAGACGCAGCGGACTTAAAATCCGCCTTCCCCTGGAAATGC |
Downstream region at tRNA end position |
gcaaagatga |
Secondary structure (Cloverleaf model) | >C191002770 Leu TAA t ACCA gcaaagatga G - C C - G G - C G - C A - T C - G G - C T G T C G C C C A T A A G | | | | | A C A G C G G C G G G C G | | | T T G A C G C T A G A CTTCCCCTGGAAAT G - C C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |