Sequence ID | >C191005649 |
Genome ID | AP018828 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Asticcacaulis excentricus M6 [AP018827, AP018828] |
Start position on genome | 828060 |
End posion on genome | 828133 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tgcctcaagg |
tRNA gene sequence |
GCGGGTATAGCACAATGGTAGTGCAGCAGCCTTCCAAGCTGAGGATGTCGGTTCGATCCC |
Downstream region at tRNA end position |
aaatcttccc |
Secondary structure (Cloverleaf model) | >C191005649 Gly TCC g TCCA aaatcttccc G - C C - G G - C G - C G - C T - A A - T C T T C T G C C A A A A | | | | G T C A C G G T C G G C G | | | | T T G G T G C T A A GGAT G A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |