Sequence ID | >C191006368 |
Genome ID | AP019004 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Phascolarctobacterium faecium JCM 30894 [AP019004] |
Start position on genome | 404894 |
End posion on genome | 404970 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ccccaccaat |
tRNA gene sequence |
GGCCCGGTGGTTCAGTTGGTTAGAATGCCGCCCTGTCACGGCGGAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
ttttgcctcg |
Secondary structure (Cloverleaf model) | >C191006368 Asp GTC t GCCA ttttgcctcg G - C G + T C - G C - G C - G G - C G - C T G T T A C C C A T G A G + | | | | G T C T T G G T G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |