Sequence ID | >C191006853 |
Genome ID | AP019195 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Aeromonas caviae GSH8M-1 [AP019195] |
Start position on genome | 735770 |
End posion on genome | 735845 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcatatccca |
tRNA gene sequence |
GGTCGTTTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGTCACTGGTTCGAGC |
Downstream region at tRNA end position |
tgctttaaaa |
Secondary structure (Cloverleaf model) | >C191006853 Val TAC a ACCA tgctttaaaa G - C G - C T - A C - G G - C T - A T - A C G T T G A C C A C G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |