Sequence ID | >C191022910 |
Genome ID | CP022958 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Azoarcus sp. DD4 [CP022958] |
Start position on genome | 2923181 |
End posion on genome | 2923106 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tcagatagtg |
tRNA gene sequence |
GCGGCATTAGCTCAGTTGGTAGAGCGTTGGATTGTGGCTCCAAAGGTCACCGGTTCGAAA |
Downstream region at tRNA end position |
aataattagg |
Secondary structure (Cloverleaf model) | >C191022910 His GTG g CCCA aataattagg G - C C - G G - C G + T C - G A - T T - A A A T T G G C C A T G A A | | | | | G T C T C G A C C G G C G | | | | T T G G A G C T A G AGGTC T - A T - A G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |