Sequence ID | >C191028487 |
Genome ID | CP024736 |
Search identical group | |
Phylum/Class | Verrucomicrobiota |
Species | Akkermansia muciniphila EB-AMDK-1 [CP024736] |
Start position on genome | 1721092 |
End posion on genome | 1721169 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ccaaggttat |
tRNA gene sequence |
GGAGCGGTAGCTCAGTTCGGTTAGAGCGCCAGCCTGTCACGCTGGAGGTCGCGGGTTCGA |
Downstream region at tRNA end position |
ccttgttcag |
Secondary structure (Cloverleaf model) | >C191028487 Asp GTC t GCCA ccttgttcag G - C G + T A - T G - C C - G G - C G - C C G T T G C C C A T T G A A + | | | | G C C T C G G C G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |