Sequence ID | >C191030359 |
Genome ID | CP025228 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Actinomyces qiguomingii 410 [CP025228] |
Start position on genome | 13852 |
End posion on genome | 13927 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
cgcgtcgcaa |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCGCATCCCTGATAAGGATGAGGTCGCTGGTTCAAG |
Downstream region at tRNA end position |
tccgcggtgg |
Secondary structure (Cloverleaf model) | >C191030359 Ile GAT a ACCg tccgcggtgg G - C G - C G - C C - G C - G T - A A - T T G T C G A C C A T G A A | | | | | A T C T C G G C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T - A C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |