Sequence ID | >C191037496 |
Genome ID | CP025823 |
Search identical group | |
Phylum/Class | Verrucomicrobiota |
Species | Akkermansia muciniphila EB-AMDK-7 [CP025823] |
Start position on genome | 956819 |
End posion on genome | 956734 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cacttcaagt |
tRNA gene sequence |
GGGTAGATTCCCGAGCGGTCAAAGGGGGCAGACTGTAAATCTGTTAGCATTTGCTTTCGA |
Downstream region at tRNA end position |
cttttcattt |
Secondary structure (Cloverleaf model) | >C191037496 Tyr GTA t ACCA cttttcattt G - C G - C G - C T - A A - T G - C A - T T A T C T T C C A C G A T | | | | | G G G C C C G A A G G C G | | | T T T A G G G C A A G TAGCATTTGCTTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |