Sequence ID | >C191037911 |
Genome ID | CP025831 |
Search identical group | |
Phylum/Class | Verrucomicrobiota |
Species | Akkermansia muciniphila EB-AMDK-16 [CP025831] |
Start position on genome | 2135328 |
End posion on genome | 2135246 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgcttcacgt |
tRNA gene sequence |
GCCGTCGTGGCGGAATGGTAGACGCGCTCGACTCAAAATCGAGTTCCAAAAGAGTGTGGG |
Downstream region at tRNA end position |
atcaataaac |
Secondary structure (Cloverleaf model) | >C191037911 Leu CAA t ACCA atcaataaac G + T C - G C - G G - C T + G C - G G - C T G T C A C C C A T A A G | | | | | G G G G C G G T G G G C G | | | T T T A C G C A G G TTCCAAAAGAGT C - G T - A C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |