Sequence ID | >C191039806 |
Genome ID | CP025987 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Marinomonas sp. FW-1 [CP025987] |
Start position on genome | 3751425 |
End posion on genome | 3751342 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ctgagtacgt |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGAGCAGATTGTAAATCTGCCACGAAAGTTTCGGTG |
Downstream region at tRNA end position |
attgcgggta |
Secondary structure (Cloverleaf model) | >C191039806 Tyr GTA t ACCA attgcgggta G - C G - C A - T G - C G - C G - C G + T T A T C C A C C A T G A T | | | | | G G G C C C G G T G G C G | | | T T C A G G G C A A A CACGAAAGTTTC G - C C - G A - T G - C A - T T A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |