Sequence ID | >C191043615 |
Genome ID | CP026455 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Bordetella pertussis J258 [CP026455] |
Start position on genome | 1835368 |
End posion on genome | 1835444 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tctctttaca |
tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGTACTTGGCTACGAACCAAGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
catttacggt |
Secondary structure (Cloverleaf model) | >C191043615 Arg ACG a GCCA catttacggt G - C C - G G - C C - G C - G C - G G - C T A T C G T C C A T G A A | + + | | G T C T C G G T G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |