Sequence ID | >C191051713 |
Genome ID | CP027565 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Weissella confusa VTT E-90392 [CP027565] |
Start position on genome | 599592 |
End posion on genome | 599663 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gaattatttt |
tRNA gene sequence |
GCGGATGTAGTACAATGGCTAGTGCTCCAGCCTTCCAAGCTGGGAATGCGGGTTCGATTC |
Downstream region at tRNA end position |
ttgttttatg |
Secondary structure (Cloverleaf model) | >C191051713 Gly TCC t Tttt ttgttttatg G - C C - G G - C G - C A - T T + G G - C T T T T G C C C A T A A A + | | | | G G C A T G G C G G G C G | | + | T T C G T G C T A T GAAT C - G C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |