Sequence ID | >C191057530 |
Genome ID | CP028460 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium animalis subsp. animalis CNCM I-4602 [CP028460] |
Start position on genome | 472526 |
End posion on genome | 472614 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aatgcagcat |
tRNA gene sequence |
GGAGTCATGCCTGAGTGGCCGATAGGGGCACCCTGCTAAGGTGTTAGTCGTGTTTAGCGG |
Downstream region at tRNA end position |
tcagggcgaa |
Secondary structure (Cloverleaf model) | >C191057530 Ser GCT t GCga tcagggcgaa G - C G - C A - T G - C T - A C - G A - T T A T C T C C C A T G A G | | | | | G G G T C C G A G G G C G + | | | T T C T A G G C G A G TAGTCGTGTTTAGCGGCTC G + T C - G A - T C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |