Sequence ID | >C191071710 |
Genome ID | CP030053 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Bradyrhizobium guangzhouense CCBAU 51670 [CP030053] |
Start position on genome | 1536489 |
End posion on genome | 1536565 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgatccctgt |
tRNA gene sequence |
GGCGGGGTAGCTCAGCTGGTTAGAGCACGGGAATCATAATCCTGGGGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
atcatccctc |
Secondary structure (Cloverleaf model) | >C191071710 Met CAT t ACCA atcatccctc G + T G - C C - G G - C G - C G - C G - C T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T T A A GGGTC C - G G + T G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |