Sequence ID | >C191079878 |
Genome ID | CP031760 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas piscicida DE1-A [CP031759, CP031760] |
Start position on genome | 1182683 |
End posion on genome | 1182607 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
aagcacaagt |
tRNA gene sequence |
CGGCATATAGCGCAGCTTGGTAGCGCACTGTCATGGGGTGTCAGGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
gcttttcctt |
Secondary structure (Cloverleaf model) | >C191079878 Pro GGG t ACCA gcttttcctt C - G G - C G - C C - G A - T T - A A - T T A T C G T C C A C G A A | | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A G - C T T C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |