Sequence ID | >C191083530 |
Genome ID | CP031965 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Aquimarina sp. AD10 [CP031965] |
Start position on genome | 2593982 |
End posion on genome | 2593909 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gccgttaaaa |
tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGTAGAGCGTCAGCCTTCCAAGCTGAATGTCGCCGGTTCGAAC |
Downstream region at tRNA end position |
aagccttatc |
Secondary structure (Cloverleaf model) | >C191083530 Gly TCC a TCaa aagccttatc G - C C - G G - C G - C G - C A - T G - C C A T T G G C C A T G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |