Sequence ID | >C191094547 |
Genome ID | CP032762 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus sp. P1Y [CP032762] |
Start position on genome | 4391624 |
End posion on genome | 4391699 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgtagttatg |
tRNA gene sequence |
GTGGGCGTAGTTCAGCTGGTAGAGCACCAGGTTGTGATCCTGGATGTCGCGGGTTCGAGT |
Downstream region at tRNA end position |
tagaagcaga |
Secondary structure (Cloverleaf model) | >C191094547 His GTG g CCCA tagaagcaga G - C T - A G - C G + T G - C C - G G - C T G T T G C C C A C G A A + | | | | G T C T T G G C G G G C G | | + | T T G G A G C T A A ATGTC C - G C - G A - T G - C G - C T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |