Sequence ID | >C191099694 |
Genome ID | CP033065 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas agarivorans Hao 2018 [CP033065, CP033066] |
Start position on genome | 744859 |
End posion on genome | 744943 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gaaaaatgac |
tRNA gene sequence |
GCCAGCGTGATGAAATTGGTATACATGGGGGATTCAAAATCCCCTGCCGAAAGGCGTGCC |
Downstream region at tRNA end position |
ctttttatga |
Secondary structure (Cloverleaf model) | >C191099694 Leu CAA c ACCA ctttttatga G + T C - G C - G A - T G - C C - G G - C C G T C G G C C A T A A G | | | | | G T A G T A G C C G G C G | | | T T G A C A T T A T G TGCCGAAAGGCGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |