Sequence ID | >C191106429 |
Genome ID | CP033465 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium sp. JN-1 [CP033465] |
Start position on genome | 2586446 |
End posion on genome | 2586371 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ctccaaaatt |
tRNA gene sequence |
GCCCATGTAGCTCAGTTGGCAGAGCGTCACCTTGGTAAGGTGGAGGTCACCGGTTCAATC |
Downstream region at tRNA end position |
gtaagataaa |
Secondary structure (Cloverleaf model) | >C191106429 Thr GGT t TCCA gtaagataaa G - C C - G C - G C - G A - T T - A G - C C T T T G G C C A T G A A | | | | | A T C T C G A C C G G C G | | | | T T G G A G C C A G AGGTC T + G C - G A - T C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |