Sequence ID | >C191108117 |
Genome ID | CP033580 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter ethanolicus JW 200 [CP033580] |
Start position on genome | 2858665 |
End posion on genome | 2858591 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tgtcttttgt |
tRNA gene sequence |
GGCCCCGTGGTCAAGAGGTTAAGACACCGCCCTTTCACGGCGGCAACACGGGTTCGAATC |
Downstream region at tRNA end position |
tttaagttaa |
Secondary structure (Cloverleaf model) | >C191108117 Glu TTC t ACCA tttaagttaa G - C G + T C - G C - G C - G C - G G - C T A T T G C C C A A G A G | | | | | G G A C T G A C G G G C G | | | T T T A G A C T A A CAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |