Sequence ID | >C191114631 |
Genome ID | CP033897 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium gerontici W8 [CP033897] |
Start position on genome | 1042920 |
End posion on genome | 1042844 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttcatccgac |
tRNA gene sequence |
GCCCCAGTAGCCCAATTGGCAGAGGCAACGGATTCAAAACCCGTCCAGTGTGAGTTCGAG |
Downstream region at tRNA end position |
ctaccggcgc |
Secondary structure (Cloverleaf model) | >C191114631 Leu CAA c ACCA ctaccggcgc G - C C - G C - G C - G C - G A - T G - C T G T C A C T C A T A A A | | | | | G T C C C G G T G A G C G | | | T T G A G G C C A G A CCAGT A - T C - G G - C G - C A C T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |