Sequence ID | >C191120349 |
Genome ID | CP034152 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus sp. NJ-530 [CP034152] |
Start position on genome | 5123474 |
End posion on genome | 5123547 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tctgcgccgc |
tRNA gene sequence |
GCCCCTATAGCTCAGTTGGTAGAGCTACGGACTTTTAATCCGCAGGTCGTAGGTTCGAGT |
Downstream region at tRNA end position |
acacagaccc |
Secondary structure (Cloverleaf model) | >C191120349 Lys TTT c ACaa acacagaccc G - C C - G C - G C - G C - G T + G A - T T G T C A T C C A T G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A T AGGTC A C C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |