Sequence ID | >C191122142 |
Genome ID | CP034240 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Aliivibrio salmonicida VS224 [CP034240, CP034241] |
Start position on genome | 916982 |
End posion on genome | 917066 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ctagaagaac |
tRNA gene sequence |
GCGGACGTGGCGGAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGTAAGGTGTGAG |
Downstream region at tRNA end position |
tatttttgac |
Secondary structure (Cloverleaf model) | >C191122142 Leu TAG c ACCA tatttttgac G - C C - G G - C G - C A - T C - G G - C T G T C T C T C A T A A G | | | | | A T G G C G G A G A G C G | | | T T G A C G C T A G A CGCCGTAAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |