Sequence ID | >C191125360 |
Genome ID | CP034439 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas sp. Xi13 [CP034439, CP034440] |
Start position on genome | 2034774 |
End posion on genome | 2034850 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
attaagcaat |
tRNA gene sequence |
ACGACCGTAGCTCAGTTGGTTAGAGCGCTACCTTGACATGGTAGAGGTCGGTGGTTCGAA |
Downstream region at tRNA end position |
aatttattct |
Secondary structure (Cloverleaf model) | >C191125360 Val GAC t ACCA aatttattct A - T C - G G - C A - T C - G C - G G - C T A T T C A C C A T G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |