Sequence ID | >C191141120 |
Genome ID | CP035417 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Leisingera sp. NJS204 [CP035417] |
Start position on genome | 2380163 |
End posion on genome | 2380239 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ggctcctcaa |
tRNA gene sequence |
CGGGCTATGGCGCAGCCTGGTAGCGCGTCCGTCTGGGGGACGGAAGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
tatgaaaaac |
Secondary structure (Cloverleaf model) | >C191141120 Pro GGG a ACCA tatgaaaaac C - G G - C G - C G - C C - G T - A A - T T G T C G T C C A C G A G | | | | | G C C G C G G C A G G C T | | | | T T G G C G C G T A G AGGTC T - A C - G C - G G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |