Sequence ID | >C191149429 |
Genome ID | CP036256 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas oryzae BAI23 [CP036256] |
Start position on genome | 2643346 |
End posion on genome | 2643421 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ccaaagacgt |
tRNA gene sequence |
GGGGCGGTAGCTCAGCTGGGAGAGCGTCGCGTTCGCATCGCGAAGGTCGAGGGTTCGATC |
Downstream region at tRNA end position |
ctattcagcg |
Secondary structure (Cloverleaf model) | >C191149429 Ala CGC t ACCA ctattcagcg G - C G - C G + T G - C C - G G - C G - C C T T T T C C C A C G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C G A G AGGTC T - A C - G G - C C - G G - C T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |