Sequence ID | >C191149518 |
Genome ID | CP036258 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium pseudotuberculosis Cap1R [CP036258] |
Start position on genome | 14286 |
End posion on genome | 14359 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tgtctgcacc |
tRNA gene sequence |
GGGGCATTAGCTCAATTGGTAGAGCACCTGCTTTGCAAGCAGGAGGTCAGGAGTTCGATT |
Downstream region at tRNA end position |
tatgaagaag |
Secondary structure (Cloverleaf model) | >C191149518 Ala TGC c ACgg tatgaagaag G - C G - C G + T G - C C - G A - T T - A T T T T C C T C A T A A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C T A A AGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |