Sequence ID | >C191149792 |
Genome ID | CP036300 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Klebsiella pneumoniae subsp. pneumoniae WCHKP015093 [CP036300] |
Start position on genome | 2390283 |
End posion on genome | 2390207 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gcaccataat |
tRNA gene sequence |
GCGTTTATAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGTTGGTTCGAG |
Downstream region at tRNA end position |
taatgcgtct |
Secondary structure (Cloverleaf model) | >C191149792 Val GAC t ACCA taatgcgtct G - C C - G G - C T - A T - A T - A A - T T G T T A A C C A T G A A + | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |