Sequence ID | >C191150910 |
Genome ID | CP036403 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Ornithinimicrobium sp. HY006 [CP036403] |
Start position on genome | 3503400 |
End posion on genome | 3503473 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
caacggatag |
tRNA gene sequence |
GCCCCCATCGTCTAGTGGCCTAGGACCCCGCCCTTTCACGGCGGTAGCACGGGTTCGAAT |
Downstream region at tRNA end position |
aggtcttgtc |
Secondary structure (Cloverleaf model) | >C191150910 Glu TTC g GCac aggtcttgtc G + T C - G C - G C - G C - G C - G A - T T A T T G C C C A T G A C | | | | | G G T C T G A C G G G C G + | | | T T C G G A C C T A C TAGC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |