Sequence ID | >C191158570 |
Genome ID | CP038255 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Terasakiella sp. SH-1 [CP038255] |
Start position on genome | 3786357 |
End posion on genome | 3786433 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
taaggctttt |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTAGTTCAAA |
Downstream region at tRNA end position |
ttttgcttct |
Secondary structure (Cloverleaf model) | >C191158570 Ile GAT t ACCA ttttgcttct G - C G - C G - C C - G C - G T - A A - T T A T C C A T C A T G A A | | | | | A T C T C G G G T A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |