Sequence ID | >C191159137 |
Genome ID | CP038273 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella israelensis Bercovier 4 [CP038273] |
Start position on genome | 636776 |
End posion on genome | 636701 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gagttgttga |
tRNA gene sequence |
GGGTGCTTAGCTCAGCTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCGCAGGTTCGATC |
Downstream region at tRNA end position |
agatttggag |
Secondary structure (Cloverleaf model) | >C191159137 Val TAC a ACCA agatttggag G - C G - C G - C T - A G - C C - G T - A C T T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |