Sequence ID | >C191162811 |
Genome ID | CP038872 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pasteurella multocida FCf71 [CP038872] |
Start position on genome | 1509673 |
End posion on genome | 1509597 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tttttacagt |
tRNA gene sequence |
CGGCGAGTAGCGCAGCTTGGTAGCGCAACTGGTTTGGGACCAGTGGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
ttttttgttc |
Secondary structure (Cloverleaf model) | >C191162811 Pro TGG t ACCA ttttttgttc C - G G - C G - C C - G G - C A - T G - C T A T T A T C C A C G A A + | | | | A T C G C G G T A G G C T | | | | T T G G C G C G T A A GGGTC A - T C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |