Sequence ID | >C191164587 |
Genome ID | CP039287 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Cupriavidus necator H16 [CP039287, CP039288] |
Start position on genome | 2732731 |
End posion on genome | 2732641 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cggacttccc |
tRNA gene sequence |
GGAGAGATGGATGAGTGGTTTAAGTCGCACGCCTGGAAAGCGTGTATAGGTTAATAGCCT |
Downstream region at tRNA end position |
gaacactatg |
Secondary structure (Cloverleaf model) | >C191164587 Ser GGA c GCCA gaacactatg G - C G - C A - T G - C A - T G - C A - T T A T C C C C C A T G A G | | | | | G G G T A G G G G G G C G + | | T T T A G T C T T A G TATAGGTTAATAGCCTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |