| Sequence ID | >C191164688 |
| Genome ID | CP039291 |
| Phylum/Class | Actinomycetota |
| Species | Cellulomonas shaoxiangyii Z28 [CP039291] |
| Start position on genome | 3142338 |
| End posion on genome | 3142263 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
cccgtccctc |
| tRNA gene sequence |
GCGCCTGTAGCTCAGGGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGGCAGTTCGAAT |
| Downstream region at tRNA end position |
cgtctccgca |
| Secondary structure (Cloverleaf model) | >C191164688 Arg CCT
c ACCA cgtctccgca
G - C
C - G
G - C
C - G
C - G
T - A
G - C T A
T C C G T C A
G G A A | | | | | G
G C T C G G G C A G C
G | | | | T T
A G A G C
T A A GTGTC
C - G
C - G
G - C
C - G
T - A
C A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |