Sequence ID | >C191166149 |
Genome ID | CP039451 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Psychroserpens sp. NJDZ02 [CP039451] |
Start position on genome | 2007493 |
End posion on genome | 2007567 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ataacgcaac |
tRNA gene sequence |
GGTCTGGTAGTTCAGCTGGTTAGAATGTCGCCCTGTCACGGCGAAGGTCGCGGGTTCGAA |
Downstream region at tRNA end position |
aaattgctaa |
Secondary structure (Cloverleaf model) | >C191166149 Asp GTC c GCaa aaattgctaa G - C G - C T - A C - G T - A G - C G - C T A T T G C C C A C G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A G AGGTC T - A C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |