Sequence ID | >C191171170 |
Genome ID | CP039702 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium butyricum [CP039702] |
Start position on genome | 474222 |
End posion on genome | 474296 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ggttacatat |
tRNA gene sequence |
TGGGATGTCGCCAAGCGGTAAGGCAATGGACTTTGACTCCATTATGCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tttatttaat |
Secondary structure (Cloverleaf model) | >C191171170 Gln TTG t GCCA tttatttaat T - A G - C G - C G - C A - T T - A G - C T A T C G T C C A G A C | + | | | G C A C C G G T A G G C G | | | T T G A G G C T A A TATGC A - T T - A G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |