Sequence ID | >C191172794 |
Genome ID | CP039889 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Agrobacterium tumefaciens CFBP5499 [CP039888, CP039889] |
Start position on genome | 1151774 |
End posion on genome | 1151700 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccgccacgga |
tRNA gene sequence |
GGGCGTGTAGCTCAGCGGGAGAGCACTACGTTGACATCGTAGGGGTCACAGGTTCAATCC |
Downstream region at tRNA end position |
tccgaattca |
Secondary structure (Cloverleaf model) | >C191172794 Val GAC a ACCA tccgaattca G - C G - C G - C C - G G - C T - A G - C C T T T G T C C A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |