Sequence ID | >C191172891 |
Genome ID | CP039898 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Agrobacterium tumefaciens CFBP5877 [CP039897, CP039898] |
Start position on genome | 740774 |
End posion on genome | 740858 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcagcgaaat |
tRNA gene sequence |
GCGGGTGTGGTGGAATTGGTAGACGCGCCGGACTCAAAATCCGGTTCCGAAAGGAGTGTC |
Downstream region at tRNA end position |
cctctaatga |
Secondary structure (Cloverleaf model) | >C191172891 Leu CAA t ACCA cctctaatga G - C C - G G - C G - C G - C T - A G - C C G T C A G C C A T A A G | | | | | G T G G T G G T C G G C G | + | T T G A C G C T A G G TTCCGAAAGGAGT C - G C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |