Sequence ID | >C191174052 |
Genome ID | CP040018 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Arthrobacter sp. 24S4-2 [CP040018] |
Start position on genome | 3415719 |
End posion on genome | 3415792 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gcatgttcac |
tRNA gene sequence |
GGGGACGTAGCTTAGTGGTAAAGCCTCAGTCTTCCAAACTGATGATGCGGGTTCGATTCC |
Downstream region at tRNA end position |
aggacagtgt |
Secondary structure (Cloverleaf model) | >C191174052 Gly TCC c TCCA aggacagtgt G - C G - C G - C G - C A - T C - G G - C T T T T G C C C A G A A + | | | | G T T T C G G C G G G C G | | | | T T G A A G C T A C TGAT T - A C - G A - T G - C T - A C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |