Sequence ID | >C191174177 |
Genome ID | CP040021 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salinivibrio kushneri AL184 [CP040021, CP040022] |
Start position on genome | 318012 |
End posion on genome | 318087 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ggacgccatt |
tRNA gene sequence |
GGGTTGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCACAGGTTCGAAT |
Downstream region at tRNA end position |
cactatcgtg |
Secondary structure (Cloverleaf model) | >C191174177 Lys TTT t ACCA cactatcgtg G - C G - C G - C T - A T - A G - C T - A T A T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |