| Sequence ID | >C191175808 |
| Genome ID | CP040234 |
| Phylum/Class | Gammaproteobacteria |
| Species | Citrobacter sp. TBCP-5362 [CP040234] |
| Start position on genome | 1390430 |
| End posion on genome | 1390356 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
gtgccgcctc |
| tRNA gene sequence |
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC |
| Downstream region at tRNA end position |
tacatacctc |
| Secondary structure (Cloverleaf model) | >C191175808 Arg CCT
c ACCA tacatacctc
G - C
T - A
C - G
T + G
C - G
C - G
T - A T T
T C G T C C A
T A A A | | | | | G
G A T T G G C A G G C
G | | | | T T
A T A A C
T A G AGTT
A - T
G - C
C - G
C - G
C - G
C A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |