Sequence ID | >C191183490 |
Genome ID | CP040878 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus faecium HB-1 [CP040878] |
Start position on genome | 2043297 |
End posion on genome | 2043382 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aacatgtgaT |
tRNA gene sequence |
GCGGCTATGGCGGAATTGGCAGACGCGCTAGCTTCAGGCGCTAGTGAGGGCGACCTCGTG |
Downstream region at tRNA end position |
tttttttata |
Secondary structure (Cloverleaf model) | >C191183490 Leu CAG T ATaa tttttttata G - C C - G G - C G - C C - G T - A A - T T A T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C C A G G TGAGGGCGACCTCGT C - G T - A A - T G - C C - G T C T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |