Sequence ID | >C191189120 |
Genome ID | CP041243 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Brevundimonas sp. M20 [CP041243] |
Start position on genome | 2269013 |
End posion on genome | 2269087 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tcggaaagag |
tRNA gene sequence |
GCCGCCGTAGCTCAGTGGTAGAGCGCATCCTTGGTAAGGCTGAGGTCGTGGGTTCGATTC |
Downstream region at tRNA end position |
ttctgaagtc |
Secondary structure (Cloverleaf model) | >C191189120 Thr GGT g ACCA ttctgaagtc G - C C - G C - G G - C C - G C - G G - C T T T C C C C C A G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G AGGTC C - G A - T T C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |